Ikan kerong-kerong merupakan salah satu potensi sumberdaya perikanan yang bernilai komersial, ikan ini sering dirtangkap oleh nelayan yang menggunakan alat tangkap tugu dan pukat gondrong. tujuan dari penelitian ini adalah untuk mengetahui identitas spesies ikan kerong-kerong yang diperdagangkan di pasar beringin kota tarakan dengan menggunakan karakteristik morfologi dan molekuler. florosafe dna stain agar dna teramati di bawah sinar uv, primer universal fishf1 (5’-tcaaccaaccc aaagacattggcac-3’) dan primer fishr1 (5’-tagacttctgggtggccaaa gaatca-3’), untuk mendeteksi keberadaan dna ikan secara universal, dan templet dna sebagai cetakan untuk membentuk molekul dna. genomic dna mini kit (tissue protocol). sekuensing tersebut dicocokkan dengan database yang ada di bank gen ncbi juga terdapat 87 sekuen yang memiliki kemiripan berkisar 98.44 - 100.00%. keragaman genetik ikan kerong-kerong yang tinggi mampu menyediakan keragaman respon yang penting untuk menjaga proses adaptasi spesies dalam perubahan kondisi lingkungansekuen di penelitian ini ditemukan jarak genetik terdekat yaitu 0.000 yang berasal dari perairan malaysia, india, bangladesh dan francis. dari hasil blast sekuen ikan kerong-kerong yang berasal dari pasar beringin kota tarakan membentuk clade yang sama dengan ikan kerong-kerong yang berasal dari malaysia, india, bangladesh, dan francis dengan nilai bootstrap 95.

Kerong-kerong fish is one of the potential fishery resources that has commercial value, this fish is often caught by fishermen using tugu fishing gear and long trawls. the purpose of this study was to determine the species identity of the kerong-kerong fish traded at the banyan market in tarakan city by using morphological and molecular characteristics. florosafe dna stain so that dna can be observed under uv light, universal primer fishf1 (5'-tcaaccaaccc aaagacattggcac-3') and primer fishr1 (5'- tagacttctgggtggccaaa gaatca-3'), to detect the universal presence of fish dna, and dna template as a template to form the dna molecule. genomic dna mini kit (tissue protocol). the sequences were matched with the existing database in the ncbi gene bank. there were also 87 sequences that had similarities ranging from 98.44 - 100.00%. the high genetic diversity of mussels is able to provide a diversity of responses that are important to maintain the adaptation process of the species in changing environmental conditions. the sequences in this study found the closest genetic distance to be 0.000 from the waters of malaysia, india, bangladesh and francis. from the blast results, the kerong-kerong fish sequence from the beringin market, tarakan city, forms the same clade as the kerong-kerong fish from malaysia, india, bangladesh, and francis with a bootstrap value of 95.